TYPE III-A CRISPR/CAS SYSTEMS AND COMPARISON OF CAS1, CAS2, AND CAS10 PROTEINS OF LACTOBACILLI

Main Article Content

OZGE KAHRAMAN ILIKKAN
https://orcid.org/0000-0001-5843-6868

Abstract

The most abundant CRISPR systems are type I and type II in lactic acid bacteria, however, type III also exists in a few genera. In this study, lactobacilli that possess a type III-A CRISPR system were detected and Cas10 signature nucleases, Cas1, Cas2 proteins, and repeat sequences were compared. 39 strains belonging to 9 species had Type III-A CRISPR system within all lactobacilli. Ligilactobacillus salivarius strains had the most abundant type III-A system among all species. “agtaagaacatatctccgaatataggagacgaaaac” was the most frequent repeat sequence and the secondary structure was predicted using the RNAfold analysis tool. Cas1, Cas2, and Cas10 amino acid sequence alignment and the phylogenetic tree revealed that the strains tended to split into branches according to species. L. ruminis ATCC 27782 and ATCC 27780 had IS66 family insertion sequence element accessory protein TnpB between cas6 and CRISPR array, and also, DEDDh genes. The endogenous Cas10 enzyme of type III-A CRISPR systems has recently started being utilized in genetic engineering studies, and reprogrammed type III-A systems have been evaluated for endogenous genome editing. Therefore, this study retraced type III-A CRISPR systems of lactobacilli to evaluate clustering of repeat sequences, Cas1, Cas2, Cas10 proteins among strain, and also intended to discover lactobacilli as a candidate for utilization in reprogrammed endogenous genome editing in the future.

Keywords:
Type III-A, CRISPR/Cas, Cas10, repeat sequence, lactobacilli

Article Details

How to Cite
ILIKKAN, O. K. (2021). TYPE III-A CRISPR/CAS SYSTEMS AND COMPARISON OF CAS1, CAS2, AND CAS10 PROTEINS OF LACTOBACILLI. Asian Journal of Microbiology and Biotechnology, 6(1), 1-9. Retrieved from https://ikpresse.com/index.php/AJMAB/article/view/6120
Section
Short Research Articles

References

Salvetti E, Torriani S, Felis GE. The Genus Lactobacillus: A Taxonomic Update, Probiotics Antimicrob. Proteins. 2012;4:217–226.
Available:https://doi.org/10.1007/s12602-012-9117-8.

Rossi F, Amadoro C, Colavita G. Members of the lactobacillus genus complex (LGC) as opportunistic pathogens: A review, Microorganisms. 2019;7:1–15.
Available:https://doi.org/10.3390/microorganisms7050126.

Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, O’toole PW, Pot B, Vandamme P, Walter J, Watanabe K, Wuyts S, Felis GE, Gänzle MG, Lebeer S. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int. J. Syst. Evol. Microbiol; 2020.
Available:https://doi.org/10.1099/ijsem.0.004107.

Hidalgo-Cantabrana C, Crawley AB, Sanchez B, Barrangou R. Characterization and exploitation of CRISPR loci in Bifidobacterium longum, Front. Microbiol. 2017;8:1–16.
Available:https://doi.org/10.3389/fmicb.2017.01851.

Roberts A, Barrangou R. Applications of CRISPR-Cas systems in Lactic Acid Bacteria. FEMS Microbiol. Rev. 2020;1–15.
Available:https://doi.org/10.1093/femsre/fuaa016.

Stout E, Klaenhammer T, Barrangou R. CRISPR-cas technologies and applications in food bacteria, Annu. Rev. Food Sci. Technol. 2017;8:413–437.
Available:https://doi.org/10.1146/annurev-food-072816-024723.

Crawley AB, Henriksen ED, Stout E, Brandt K, Barrangou R. Characterizing the activity of abundant, diverse and active CRISPR-Cas systems in lactobacilli. Sci. Rep. 2018;1–12.
Available:https://doi.org/10.1038/s41598-018-29746-3.

Makarova KS, Haft DH, Barrangou R, Brouns SJJ, Charpentier E, Horvath P, Moineau S, Mojica FJM, Wolf YI, Yakunin AF, Van Der Oost J, Koonin EV. Evolution and classification of the CRISPR-Cas systems, Nat. Rev. Microbiol. 2011;9:467–477.
Available:https://doi.org/10.1038/nrmicro2577.

Sontheimer EJ, Marraffini LA. CRISPR intereference: RNA-directed adaptive immunity in bacteria and archaea, Nat. Rev. Genet. 2010;11:181–190.
Available:https://doi.org/10.1038/nrg2749.CRISPR.

Barrangou R, Fremaux C, Deveau H, Richardss M, Boyaval P, Moineau S, Romero DA, Horvath P. CRISPR provides against viruses in prokaryotes. Science. 2007;315:1709–1712.

Alkhnbashi OS, Meier T, Mitrofanov A, Backofen RB. Voß, CRISPR-Cas bioinformatics, Methods. 2020;3–11.
Available:https://doi.org/10.1016/j.ymeth.2019.07.013.

Briner AE, Lugli GA, Milani C, Duranti S, Turroni F, Gueimonde M, Margolles A, Van Sinderen D, Ventura M, Barrangou R. Occurrence and diversity of CRISPR-Cas systems in the genus bifidobacterium, PLoS One. 2015;10:1–16.
Available:https://doi.org/10.1371/journal.pone.0133661.

Lopatina A, Medvedeva S, Artamonova D, Kolesnik M, Sitnik V, Ispolatov Y, Severinov K. Natural diversity of CRISPR spacers of Thermus: Evidence of local spacer acquisition and global spacer exchange, Philos. Trans. R. Soc. B Biol. Sci. 2019;374.
Available:https://doi.org/10.1098/rstb.2018.0092.

Biswas A, Fineran PC, Brown CM. Accurate computational prediction of the transcribed strand of CRISPR non-coding RNAs. Bioinformatics. 2014;30:1805–1813.
Available:https://doi.org/10.1093/bioinformatics/btu114.

Li Y, Peng N. Endogenous CRISPR-cas system-based genome editing and antimicrobials: Review and prospects, Front. Microbiol. 2019;10.
Available:https://doi.org/10.3389/fmicb.2019.02471.

Jia N, Mo CY, Wang C, Eng ET, Marraffini LA, Patel DJ. Type III-A CRISPR-Cas Csm Complexes: Assembly, Periodic RNA Cleavage, DNase Activity Regulation, and Autoimmunity. Mol. Cell. 2019;73:264-277.e5.
Available:https://doi.org/10.1016/j.molcel.2018.11.007.

Liu TY, Liu JJ, Aditham AJ, Nogales E, Doudna JA. Target preference of Type III-A CRISPR-Cas complexes at the transcription bubble, Nat. Commun. 2019;10.
Available:https://doi.org/10.1038/s41467-019-10780-2.

Mogila I, Kazlauskiene M, Valinskyte S, Tamulaitiene G, Tamulaitis G, Siksnys V. Genetic dissection of the type III-A CRISPR-Cas System Csm Complex Reveals Roles of Individual Subunits. Cell Rep. 2019;26:2753-2765.e4.
Available:https://doi.org/10.1016/j.celrep.2019.02.029.

You L, Ma J, Wang J, Artamonova D, Wang M, Liu L, Xiang H, Severinov K, Zhang X, Wang Y. Structure studies of the CRISPR-Csm complex reveal mechanism of co-transcriptional interference, Cell. 2019;176: 239-253.e16.
Available:https://doi.org/10.1016/j.cell.2018.10.052.

Millen AM, Samson JE, Tremblay DM, Magadán AH, Rousseau GM. Lactococcus lactis type III-A CRISPR-Cas system cleaves bacteriophage RNA. RNA Biol. 2019;16:461–468.
Available:https://doi.org/10.1080/15476286.2018.1502589.

Guan J, Wang W, Sun B. Chromosomal targeting by the type III-A CRISPR-Cas System Can Reshape Genomes in Staphylococcus aureus, MSphere; 2017.
Available:https://doi.org/10.1128/msphere.00403-17.

Makarova KS, Wolf YI, Koonin EV. Classification and nomenclature of CRISPR-Cas Systems: Where from Here?, Cris. J. 2018;1:325–336.
Available:https://doi.org/10.1089/crispr.2018.0033.

Cao L, Gao CH, Zhu J, Zhao L, Wu Q, Li M, Sun B. Identification and functional study of type III-A CRISPR-Cas systems in clinical isolates of Staphylococcus aureus. Int. J. Med. Microbiol; 2016.
Available:https://doi.org/10.1016/j.ijmm.2016.08.005.

Börner RA, Kandasamy V, Axelsen AM, Nielsen AT, Bosma EF. Genome editing of lactic acid bacteria: Opportunities for food, feed, pharma and biotech, FEMS Microbiol. Lett. 2019;366:1–12.
Available:https://doi.org/10.1093/femsle/fny291.

Leenay RT, Vento JM, Shah M, Martino ME, Leulier F, Beisel CL, Leulier S, Beisel CL. Genome Editing with CRISPR-Cas9 in Lactobacillus plantarum Revealed That Editing Outcomes Can Vary Across Strains and Between Methods, Biotechnol. J. 2019; 1700583:1–11.
Available:https://doi.org/10.1002/biot.201700583.

Plavec TV, Berlec A. Safety aspects of genetically modified lactic acid bacteria, Microorganisms. 20230;8:297.
Available:https://doi.org/10.3390/microorganisms8020297.

Nakade S, Yamamoto T, Sakuma T. Cas9 Cpf1 and C2c1 / 2 / 3 ― What ’ s next ?, 2017;5979.
Available:https://doi.org/10.1080/21655979.2017.1282018.

Sanozky-Dawes R, Selle K, O’Flaherty S, Klaenhammer T, Barrangou R. Occurrence and activity of a type II CRISPR-Cas system in Lactobacillus gasseri. Microbiol. (United Kingdom). 2015;161:1752–1761.
Available:https://doi.org/10.1099/mic.0.000129.

Sayers EW, Cavanaugh M, Clark K, Ostell J, Pruitt KD, Karsch-Mizrachi I. GenBank, Nucleic Acids Res; 2020.
Available:https://doi.org/10.1093/nar/gkz956.

Grissa I, Vergnaud G, Pourcel C. The CRISPRdb database and tools to display CRISPRs and to generate dictionaries of spacers and repeats. BMC Bioinformatics. 2007;8:1–10.
Available:https://doi.org/10.1186/1471-2105-8-172.

Biswas A, Staals RHJ, Morales SE, Fineran PC, Brown CM. CRISPRDetect: A flexible algorithm to define CRISPR arrays, BMC Genomics. 2016;17:1–14.
Available:https://doi.org/10.1186/s12864-016-2627-0.

Zhang F, Zhao S, Ren C, Zhu Y, Zhou H, Lai Y, Zhou F, Jia Y, Zheng K, Huang Z. CRISPRminer is a knowledge base for exploring CRISPR-Cas systems in microbe and phage interactions. Commun. Biol. 2018;1.
Available:https://doi.org/10.1038/s42003-018-0184-6.

Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics.2012;28:1647–1649.
Available:https://doi.org/10.1093/bioinformatics/bts199.

Ipoutcha T, Tsarmpopoulos I, Talenton V, Gaspin C, Moisan A, Walker CA, Brownlie J, Blanchard A, Thebault P, Sirand-Pugnet P. Multiple Origins and Specific Evolution of CRISPR/Cas9 Systems in Minimal Bacteria (Mollicutes), Front. Microbiol. 2019;10:1–14.
Available:https://doi.org/10.3389/fmicb.2019.02701.

Singh A, Gaur M, Sharma V, Khanna P, Bothra A, Bhaduri A, Mondal AK, Dash D, Singh Y, Misra R. Comparative genomic analysis of mycobacteriaceae reveals horizontal gene transfer-mediated evolution of the CRISPR-Cas System in the Mycobacterium tuberculosis complex. MSystems. 2021;6.
Available:https://doi.org/10.1128/msystems.00934-20.

Pan M, Barrangou R. Combining omics technologies with CRISPR-based genome editing to study food microbes, Curr. Opin. Biotechnol. 2020;61:198–208.
Available:https://doi.org/10.1016/j.copbio.2019.12.027.

Hatoum-Aslan A. CRISPR-Cas10 Systems and Methods for Phage Genome Editing. 2018;15(910):620.